ID: 1151678458_1151678474

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1151678458 1151678474
Species Human (GRCh38) Human (GRCh38)
Location 17:75611834-75611856 17:75611885-75611907
Sequence CCAGGTACCACACCTGGATGCTC GGCCATCGGGACGCCCTGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 17, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!