ID: 1151680253_1151680263

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1151680253 1151680263
Species Human (GRCh38) Human (GRCh38)
Location 17:75619314-75619336 17:75619350-75619372
Sequence CCTCTGTGTGAGCAGAGGGCAGC GCCCACAGGAGGCTTGGAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 39, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!