ID: 1151680256_1151680266

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1151680256 1151680266
Species Human (GRCh38) Human (GRCh38)
Location 17:75619336-75619358 17:75619356-75619378
Sequence CCTGGGTCCTTCCTGCCCACAGG AGGAGGCTTGGAGGTGGACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 49, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!