ID: 1151683678_1151683688

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1151683678 1151683688
Species Human (GRCh38) Human (GRCh38)
Location 17:75634781-75634803 17:75634828-75634850
Sequence CCTCTGGTGATGAGCCTTGAACA ACTTTCAACTCAGGCTCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112} {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!