ID: 1151685251_1151685257

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1151685251 1151685257
Species Human (GRCh38) Human (GRCh38)
Location 17:75642413-75642435 17:75642435-75642457
Sequence CCGCCATTTCCAGCTGGCAGTCC CAGGCCACACTGGCAATAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 235} {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!