ID: 1151694068_1151694073

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1151694068 1151694073
Species Human (GRCh38) Human (GRCh38)
Location 17:75705193-75705215 17:75705217-75705239
Sequence CCCTCAGTGGCTCGCCTGGGTGC ACCTATTAGGTCCCACGTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 148} {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!