ID: 1151694069_1151694079

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1151694069 1151694079
Species Human (GRCh38) Human (GRCh38)
Location 17:75705194-75705216 17:75705241-75705263
Sequence CCTCAGTGGCTCGCCTGGGTGCT CCTGAGCACCACTTGTTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 165, 4: 762} {0: 1, 1: 1, 2: 0, 3: 18, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!