ID: 1151694608_1151694619

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1151694608 1151694619
Species Human (GRCh38) Human (GRCh38)
Location 17:75707793-75707815 17:75707827-75707849
Sequence CCTGTGACCTCCGATGGCGGCCC AGGGCACTGTGGATGTTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68} {0: 1, 1: 0, 2: 4, 3: 29, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!