ID: 1151696688_1151696692

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1151696688 1151696692
Species Human (GRCh38) Human (GRCh38)
Location 17:75721559-75721581 17:75721584-75721606
Sequence CCGAGGTAGGTCCAGGACGGGCG CAGCAGCAGCCGAGGCTGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117} {0: 1, 1: 0, 2: 3, 3: 66, 4: 460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!