ID: 1151712674_1151712685

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1151712674 1151712685
Species Human (GRCh38) Human (GRCh38)
Location 17:75815533-75815555 17:75815583-75815605
Sequence CCATGGCTGACTTGGCAAATCCC CAGACATCACTAATGGAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 550} {0: 1, 1: 1, 2: 12, 3: 41, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!