ID: 1151719656_1151719665

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1151719656 1151719665
Species Human (GRCh38) Human (GRCh38)
Location 17:75847875-75847897 17:75847908-75847930
Sequence CCCGCTGGGCATGTAAGAGTAGC ACTGGGGACTTCACCTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72} {0: 1, 1: 0, 2: 2, 3: 64, 4: 1433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!