ID: 1151727211_1151727222

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1151727211 1151727222
Species Human (GRCh38) Human (GRCh38)
Location 17:75892109-75892131 17:75892144-75892166
Sequence CCCAGCTGTTGGTCTTCATCCCA CAGTGGCCCAAGAGGCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 152} {0: 1, 1: 1, 2: 7, 3: 22, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!