ID: 1151733547_1151733561

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1151733547 1151733561
Species Human (GRCh38) Human (GRCh38)
Location 17:75925034-75925056 17:75925080-75925102
Sequence CCTTTTATGATTTCAGGGGCTTT CCTTTCCTTCTGAGGCTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 232} {0: 1, 1: 0, 2: 7, 3: 45, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!