ID: 1151744145_1151744154

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1151744145 1151744154
Species Human (GRCh38) Human (GRCh38)
Location 17:76002503-76002525 17:76002555-76002577
Sequence CCCTGCAGGTGGTGACACTGTGG CAAGTTCTATACCACAGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 242} {0: 1, 1: 0, 2: 2, 3: 10, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!