ID: 1151744500_1151744507

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1151744500 1151744507
Species Human (GRCh38) Human (GRCh38)
Location 17:76004686-76004708 17:76004728-76004750
Sequence CCACATTTCTCTCCTTAATCTGG GGGTCAGTATTTTCATCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 291} {0: 1, 1: 0, 2: 2, 3: 11, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!