ID: 1151750186_1151750198

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1151750186 1151750198
Species Human (GRCh38) Human (GRCh38)
Location 17:76032746-76032768 17:76032777-76032799
Sequence CCCTCCTCCAGCTGGGCCTAGAG TCTGGCGGACTGGGGGTTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 324} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!