ID: 1151755718_1151755727

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1151755718 1151755727
Species Human (GRCh38) Human (GRCh38)
Location 17:76074399-76074421 17:76074421-76074443
Sequence CCGGGATATCCTGCACCCCTGCC CAGGCTGCAGGGAAGCGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 226} {0: 1, 1: 0, 2: 1, 3: 30, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!