ID: 1151763466_1151763468

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1151763466 1151763468
Species Human (GRCh38) Human (GRCh38)
Location 17:76120569-76120591 17:76120590-76120612
Sequence CCTTGGATTTGAGGTAAATTAAG AGTGACATGGCGCATATAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 438} {0: 1, 1: 0, 2: 0, 3: 1, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!