ID: 1151769698_1151769708

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1151769698 1151769708
Species Human (GRCh38) Human (GRCh38)
Location 17:76152206-76152228 17:76152244-76152266
Sequence CCTTCAGCAACTGGTCTCCAGCA CCTTCTTGGCAGGAACTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 235} {0: 1, 1: 0, 2: 0, 3: 11, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!