ID: 1151790809_1151790818

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1151790809 1151790818
Species Human (GRCh38) Human (GRCh38)
Location 17:76304682-76304704 17:76304709-76304731
Sequence CCAGTTATCTGTCCCATGTGAGC AGCAGAGCGCTGGGCAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95} {0: 1, 1: 0, 2: 9, 3: 82, 4: 774}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!