|
Left Crispr |
Right Crispr |
| Crispr ID |
1151795957 |
1151795963 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:76345931-76345953
|
17:76345949-76345971
|
| Sequence |
CCTGCTCCTCCCTCCAAAGCCAG |
GCCAGAGCCCAGGCCTAAAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 4, 3: 50, 4: 550} |
{0: 3, 1: 16, 2: 21, 3: 21, 4: 229} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|