ID: 1151797813_1151797821

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1151797813 1151797821
Species Human (GRCh38) Human (GRCh38)
Location 17:76358136-76358158 17:76358165-76358187
Sequence CCTCCCACAGAAGCATTGCAGGG GTACCTGAGGAGGGAAGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 145} {0: 1, 1: 0, 2: 5, 3: 36, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!