ID: 1151805561_1151805572

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1151805561 1151805572
Species Human (GRCh38) Human (GRCh38)
Location 17:76402864-76402886 17:76402904-76402926
Sequence CCCTACAAGTTCTAGGCTGCATC TGAGGAGGAAGTGGTGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 74} {0: 2, 1: 3, 2: 41, 3: 467, 4: 3322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!