ID: 1151807100_1151807105

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1151807100 1151807105
Species Human (GRCh38) Human (GRCh38)
Location 17:76412551-76412573 17:76412583-76412605
Sequence CCTCCTGTCTCAGCTGAGGCCTC TTGGTTGTCCCTGAGCTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 375} {0: 1, 1: 0, 2: 0, 3: 15, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!