ID: 1151809578_1151809581

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1151809578 1151809581
Species Human (GRCh38) Human (GRCh38)
Location 17:76430162-76430184 17:76430205-76430227
Sequence CCTTCCACCTTCTAGAAATTGGA TCTCCCATTCTGTGTCCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 189} {0: 1, 1: 1, 2: 1, 3: 54, 4: 564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!