ID: 1151822010_1151822019

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1151822010 1151822019
Species Human (GRCh38) Human (GRCh38)
Location 17:76501563-76501585 17:76501579-76501601
Sequence CCTGCCTCCGCCCTCCACCCAGC ACCCAGCTGGGTCCCCGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 150, 4: 1906} {0: 1, 1: 0, 2: 2, 3: 14, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!