ID: 1151843185_1151843193

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1151843185 1151843193
Species Human (GRCh38) Human (GRCh38)
Location 17:76632254-76632276 17:76632295-76632317
Sequence CCCTATCTCGAACATTTTCATGG CAGGCACCTTAACTTGGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 135} {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!