ID: 1151858270_1151858274

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1151858270 1151858274
Species Human (GRCh38) Human (GRCh38)
Location 17:76737955-76737977 17:76737971-76737993
Sequence CCGGCGCCGCGGCTGCGGTCAGG GGTCAGGTGACCCGGTCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 129} {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!