ID: 1151858270_1151858285

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1151858270 1151858285
Species Human (GRCh38) Human (GRCh38)
Location 17:76737955-76737977 17:76737999-76738021
Sequence CCGGCGCCGCGGCTGCGGTCAGG GTGAGTCAGGCTGGGAGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 129} {0: 1, 1: 0, 2: 10, 3: 53, 4: 617}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!