ID: 1151866454_1151866461

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1151866454 1151866461
Species Human (GRCh38) Human (GRCh38)
Location 17:76806343-76806365 17:76806387-76806409
Sequence CCTCCCTGCGGGGCAGGGCTCCG GAGCCTCCCCGCCCCCGCCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 14, 3: 58, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!