ID: 1151876437_1151876454

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1151876437 1151876454
Species Human (GRCh38) Human (GRCh38)
Location 17:76870050-76870072 17:76870099-76870121
Sequence CCGGACTCGGGACGTGGCCACAG CGAGAAGGCGGAGCTTGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72} {0: 1, 1: 4, 2: 104, 3: 780, 4: 2318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!