ID: 1151880001_1151880007

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1151880001 1151880007
Species Human (GRCh38) Human (GRCh38)
Location 17:76889125-76889147 17:76889158-76889180
Sequence CCCATGCCAGGTACACCGAGCTG GCAGTGAGAAGATGCAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90} {0: 1, 1: 0, 2: 5, 3: 40, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!