ID: 1151880003_1151880006

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1151880003 1151880006
Species Human (GRCh38) Human (GRCh38)
Location 17:76889131-76889153 17:76889154-76889176
Sequence CCAGGTACACCGAGCTGTTTTGC AGATGCAGTGAGAAGATGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47} {0: 1, 1: 0, 2: 3, 3: 38, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!