ID: 1151881078_1151881095

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1151881078 1151881095
Species Human (GRCh38) Human (GRCh38)
Location 17:76894959-76894981 17:76895008-76895030
Sequence CCCCAACCCCCTGGCATGGACCG CTGGCTGCACAGCAGGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 185} {0: 1, 1: 2, 2: 10, 3: 61, 4: 465}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!