ID: 1151886297_1151886304

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1151886297 1151886304
Species Human (GRCh38) Human (GRCh38)
Location 17:76925095-76925117 17:76925120-76925142
Sequence CCGGTGAGAGGGCGGCCAGAGGG GGCACGTGGCCCACATGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 35, 4: 298} {0: 1, 1: 0, 2: 0, 3: 25, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!