ID: 1151895054_1151895064

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1151895054 1151895064
Species Human (GRCh38) Human (GRCh38)
Location 17:76974601-76974623 17:76974644-76974666
Sequence CCAGATGGCCTGGCGCTGCCATC GGCTGTACACTCTACAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 31, 3: 102, 4: 290} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!