ID: 1151895054_1151895064 |
View in Genome Browser |
Spacer: 20 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1151895054 | 1151895064 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 17:76974601-76974623 | 17:76974644-76974666 |
Sequence | CCAGATGGCCTGGCGCTGCCATC | GGCTGTACACTCTACAGAGCAGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 7, 2: 31, 3: 102, 4: 290} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |