|
Left Crispr |
Right Crispr |
| Crispr ID |
1151904501 |
1151904507 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:77038924-77038946
|
17:77038972-77038994
|
| Sequence |
CCAAATTGCTGGGGTTACAGGTG |
TTGCATCTTGATTTGGAGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 29, 1: 2341, 2: 81932, 3: 250765, 4: 341552} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|