ID: 1151913938_1151913946

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1151913938 1151913946
Species Human (GRCh38) Human (GRCh38)
Location 17:77103777-77103799 17:77103817-77103839
Sequence CCTGGATTTGTTTTTCATTTGAC CCCGGCTCCATGGGGTTATGAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 67, 4: 645} {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!