ID: 1151913945_1151913954

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1151913945 1151913954
Species Human (GRCh38) Human (GRCh38)
Location 17:77103817-77103839 17:77103860-77103882
Sequence CCCGGCTCCATGGGGTTATGAGG ACCGTGGATCCAGGCGGCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 156} {0: 1, 1: 0, 2: 0, 3: 1, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!