ID: 1151917859_1151917868

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1151917859 1151917868
Species Human (GRCh38) Human (GRCh38)
Location 17:77131967-77131989 17:77132010-77132032
Sequence CCAGCTTCTTGGCCCGAAGTTTT CTGTGTTAGCTCAAGGCCACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 100} {0: 1, 1: 0, 2: 2, 3: 37, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!