ID: 1151930765_1151930778

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1151930765 1151930778
Species Human (GRCh38) Human (GRCh38)
Location 17:77230211-77230233 17:77230254-77230276
Sequence CCACAGCGGGAAGCAGCAGATGC GACGGCACCCTGCCTCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 205} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!