ID: 1151946767_1151946778

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1151946767 1151946778
Species Human (GRCh38) Human (GRCh38)
Location 17:77323857-77323879 17:77323900-77323922
Sequence CCCCGTGGGAACTCTGGTCCCTG CATCACCAAGTGCCACAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 148} {0: 1, 1: 1, 2: 28, 3: 276, 4: 1069}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!