ID: 1151951144_1151951148

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1151951144 1151951148
Species Human (GRCh38) Human (GRCh38)
Location 17:77354797-77354819 17:77354821-77354843
Sequence CCTGCTTGTTGCACTTTGCGTCC TGAGGACGTTGACCCCTGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 52} {0: 1, 1: 0, 2: 1, 3: 5, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!