ID: 1151953702_1151953712

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1151953702 1151953712
Species Human (GRCh38) Human (GRCh38)
Location 17:77370000-77370022 17:77370019-77370041
Sequence CCATCCCCCTTCCCTTGGGACAG ACAGTGATCTGCTGGACGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 52, 4: 394} {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!