ID: 1151954207_1151954213

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1151954207 1151954213
Species Human (GRCh38) Human (GRCh38)
Location 17:77372683-77372705 17:77372699-77372721
Sequence CCAGGGCTCACCCAGGAGGGTGC AGGGTGCAGCGGTGGCCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 257} {0: 1, 1: 0, 2: 3, 3: 17, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!