ID: 1151961743_1151961755

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1151961743 1151961755
Species Human (GRCh38) Human (GRCh38)
Location 17:77409316-77409338 17:77409360-77409382
Sequence CCGGTGTGTCTCCTTCGTGGTGG AGAGCCTGGCTCCAGAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133} {0: 1, 1: 1, 2: 17, 3: 125, 4: 989}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!