ID: 1152015957_1152015962

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1152015957 1152015962
Species Human (GRCh38) Human (GRCh38)
Location 17:77750333-77750355 17:77750354-77750376
Sequence CCGATGGCAAGGGGGGCACTTAC ACGTGGGCATAGATGGTGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!