|
Left Crispr |
Right Crispr |
| Crispr ID |
1152019940 |
1152019946 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:77775688-77775710
|
17:77775707-77775729
|
| Sequence |
CCCTCCACGGTCTCCCTCTGATG |
GATGCCGAGCCAAAGCTGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 87, 1: 19, 2: 6, 3: 18, 4: 219} |
{0: 54, 1: 81, 2: 38, 3: 20, 4: 170} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|