|
Left Crispr |
Right Crispr |
| Crispr ID |
1152019940 |
1152019949 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:77775688-77775710
|
17:77775724-77775746
|
| Sequence |
CCCTCCACGGTCTCCCTCTGATG |
GGACGGTACTGCTGCCATCTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 87, 1: 19, 2: 6, 3: 18, 4: 219} |
{0: 125, 1: 829, 2: 365, 3: 139, 4: 530} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|