ID: 1152048947_1152048957

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1152048947 1152048957
Species Human (GRCh38) Human (GRCh38)
Location 17:77958258-77958280 17:77958282-77958304
Sequence CCCTCCCGCCAGCACCCTAACGC GAGCCACAGCGCCCAGGGACCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!